COVID-19 Update for Thursday,August 27,2020 Latest numbers from Macon County Public Health Included

From the video description:

Sars-Cov-2, the virus that causes Covid-19 is easily the most defining feature of 2020. In the last 8 months the world has changed radically and there have been plenty of fumbles as countries struggle to deal with the chaos. One of the most important issues has been testing for the virus. In this video, I aim to demystify how that testing actually works down to the chemical level and show exactly how it’s done. We’ll be covering the viruses anatomy, as well as three types of test: PCR, LAMP and Antibody.

Earlier videos:
PCR – https://youtu.be/7kJ2o7P8D00
Gel Electrophoresis – https://youtu.be/sSKls2kNC4U

More resources, and citations:

Kurzgesagt Covid Overview: https://youtu.be/BtN-goy9VOY

A great writeup about the virus’s anatomy: https://bit.ly/2FJq6G8

JOGL: https://app.jogl.io/program/opencovid19

Biofoundry: https://foundry.bio/

Student Outbreak: https://bit.ly/2Qa3vEq

Student Outbreak 2: https://bit.ly/34hQgdl

Strokes In heathy people: https://bit.ly/2QdQREK

Organ Damage: https://bit.ly/3aHONhy

Aptamer Tests: https://rsc.li/3j2Fb3I

Variations in Test Accuracy: https://bit.ly/2YlojNV

Faulty probes: https://bit.ly/3aIPlDJ

Contaminated Swabs: https://bit.ly/34fnVEt

False positives FDA: https://bit.ly/3gojBFv

E protein structure: https://bit.ly/3aN5Yyb

MERS fact sheet: https://bit.ly/2CLUaQn

Incidence of thromboembolism: https://bit.ly/2YgiBgc

Stroke study: https://bit.ly/2E59Pei

Stroke 2: https://bit.ly/2Yk8yql

Cardiac infection: https://bit.ly/3l5DaWo

Asymptomatic infection rate: https://bit.ly/2YgiOju

Asymptomatic infection study: https://go.nature.com/2CLO2rb

Organ damage in asymptomatic patients: https://bit.ly/2YfaMHJ

Wisconsin LAMP trial: https://bit.ly/3aIQfA7

Healthy people stroke: https://bit.ly/2YmKEuB

LAMP Assay design: https://bit.ly/3aJnqUv

Mutation genealogy: https://bit.ly/34hxqTs

Cardiac outcomes: https://bit.ly/3hjJBmo

False negative rate: https://bit.ly/3j47I95

ACE2 distribution: https://go.nature.com/3aJsMyR

Long Haulers article: https://bit.ly/2EgU9nP

Long haulers Video: https://youtu.be/AuKAg52mz4s

Complete protein models: https://bit.ly/32akpIS

Antibody test: https://bit.ly/2CIXT0S

Original Primers:
N1F – GACCCCAAAATCAGCGAAAT
N2F – ttacaaacattggccgcaaa
N3F – GGGAGCCTTGAATACACCAAAA
N2R – GCGCGACATTCCGAAGAA
N2-LF – gggggcaaattgtgcaatttg
N2-B3 – gacttgatctttgaaatttggatct
N2-F3 – accaggaactaatcagacaag

Back to Top

Over 1,000 US health workers died of Covid-19. Many were immigrants and minorities [LINK]

PGH doctor dies after contracting COVID-19 a second time [LINK]

Ai Weiwei releases “Coronation” – the first feature-length film on the COVID-19 outbreak in Wuhan [LINK]

Computational Gene Study Suggests New Pathway For COVID-19 Inflammatory Response [LINK]

Back to Top

Oxford trials start in Pune, 2 volunteers get their first shots of COVID-19 vaccine candidate [LINK]

Abbott Cleared for Fast $5 Covid Test That Avoids Lab Delay [LINK]

Abbott’S Fast, $5, 15-Minute, Easy-to-Use Covid-19 Antigen Test Receives Fda Emergency Use Authorization; Mobile App Displays Test Results to Help Our Return to Daily Life; Ramping Production to 50 Million Tests a Month (press release) [LINK]

Test kit finds coronavirus on surfaces in West Michigan [LINK]

Blood clots: A major problem in severe Covid-19 [LINK]

Women may mount stronger COVID-19 immune response: Study [LINK]

6 feet may not always be enough distance to protect from COVID-19 [LINK]

Woman may have caught coronavirus in airplane toilet, researchers say [LINK]

Psychologist suggests negative impact of pandemic on friendships likely to be fleeting [LINK]

Back to Top

Science, society, and policy in the face of uncertainty: reflections on the debate around face coverings for the public during COVID-19 [LINK]

Le Havre, France: Server attacked with a knife by a customer who refused to wear a mask [LINK]

Angela Merkel: Minimum fine of 50 euros for violating the mask requirement [LINK]

Back to Top

Download a PDF of “LIGHTING OUR WAY FORWARD: North Carolina’s Guidebook for Re-opening Schools” [LINK]

Tracking Coronavirus Cases at U.S. Colleges and Universities: 26,000+ Cases [LINK]

Learning experience: Pandemic calling the shots for NC schools [LINK]

All Kindergarten Students Quarantined, School Tells Parents in Late-Night Text (Mississippi) [LINK]

NC State University will close campus dorms, calling COVID situation ‘untenable’ [LINK]

Back to Top

The Exceptional American Relationship to Public Health: Why the United States Has Failed So Spectacularly to Control COVID-19 [LINK]

How superspreading is fueling the pandemic — and how we can stop it — “Any one of us could unknowingly be a superspreader.” [LINK]

Coronavirus cases fell by 15% this week [LINK]

Number of people with coronavirus hospitalized in North Alabama continues to decrease [LINK]

COVID-19 could permanently increase the amount of illness the health care system handles. [LINK]

Fauci says he was in surgery when task force discussed CDC testing guidelines [LINK]

Messaging about Covid-19 has changed too much and too often, quickly evolving from “flatten the curve” to something very different, so Americans aren’t listening [LINK]

CDC was pressured ‘from the top down’ to change coronavirus testing guidance, official says – ABC17NEWS [LINK]

NY will not be following new CDC testing guidance [LINK]

Experts Alarmed as CDC Abruptly Changes COVID-19 Advice Amid Reports of Interference [LINK]

COVID-19 cases among children surge in Georgia [LINK]

UGA worker dies from COVID-19, family said she was scared to work on campus (Georgia) [LINK]

Covid Gag Rules at U.S. Companies Are Putting Everyone at Risk [LINK]

‘You can’t get close, yet you can’t stay away’: Latino cultural beliefs clash with pandemic safety [LINK]

Governor Gavin Newsom Announces Massive 150% Increase In COVID-19 Testing, Foresees Possibility of Reopening Schools, Business [LINK]

California coronavirus testing to double capacity and speed up results [LINK]

L.A. County reports cases of newborns with COVID-19 for first time [LINK]

Back to Top

Employers Face Increase In COVID-19 Wrongful Death Lawsuits [LINK]

WHO: Coronavirus is a “tornado with a long tail” that could cause more deaths as weather cools [LINK]

Pressure on Madrid hospitals rising as Covid-19 cases surge in Spain once more [LINK]

India reports record daily jump of 75,760 coronavirus infections [LINK]

Weekly COVID-19 cases in England decline for first time since July [LINK]

EU signs contract with AstraZeneca on supply of potential COVID-19 vaccine [LINK]

Boris Johnson has hired personal trainer Harry Jameson to lose weight, after acknowledging he was “too fat” when he caught coronavirus. [LINK]

Vaccine front-runner China already inoculating workers [LINK]

people on low pay to get Covid isolation payment in UK [LINK]

Mexico to donate Mexican-made ventilators to 8 countries [LINK]

Covid “Act Of God”, We May See Economy Contract: Nirmala Sitharaman (India) [LINK]

Rape Cases In India Show No Signs Of Stopping Even During COVID-19 [LINK]

Back to Top

William & Mary cheerleader survives 3-month battle with COVID-19 [LINK]

Coronavirus NZ: Mount Roskill Evangelical Fellowship in Auckland exposes hundreds to COVID-19 [LINK]

Restaurants make plea for government support as over half of eateries face bankruptcy in next three months [LINK]

Pogba was tested positive for COVID-19 [LINK]

Back to Top

If you receive value from what Macon Media provides to the community, please consider becoming a supporter and contribute at least a dollar a month. Those who support Macon Media with at least a dollar a month receive early access to video of some events and meetings before they are made public on the website. Videos and news involving public safety are not subject to early access.