Uncontrollable Bio Climate Change!!! Morgellons Gene Sequence and Substrains!!! (Video)

Here is the gene sequence of Silent Superbug which is also called by other names such as Fiber Disease, Morgellons, and Chemtrail Sickness. There is a huge coverup of this crime against humanity. The CDC, ECDC, and Interpol in France were notified ine 2004 of the release of this synthetic model organism which was created in a proteome genomic laboratory. It was releases in 1979, 1980, 1989, 1991, and 2000.
CBL001 / OPEN SOURCE / ITS SEQUENCE
ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATT
ACTGGATCGCGAGTAAGCCCCCTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCT
CGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTTTAATTTTCAATCAGCGT
CTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGA
AGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAAT
CTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA
TTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCCCTTGCGTTTGGACTC
GCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTC
TAGCTAATAATTACTTGCAACCATCAAGTCTACCGAGGCAACTCGGTCGGGAGGACTG
CTGGCTTTCACGAGTCGGCTTTCCTTGTATTATCCAGGCCTATGTCTTACACATACCCCA
AAGAATGTAACAGAATGTATTGTATATGGCCTAGTGCCTATAAACTATATACAACTTTCAG
CAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATG
TGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATT
CCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTATTAGCTTTTGCTGATAA
TGGCTTGGACTTGGGGGTCTTTTTGCTGGCTTTCATTAGTCTGCTCCCCTTAAATGTATTA
GCCGGTGCCCCGCAGTGGAACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTC
TGCTATAATGGGTTTGCGCTGCTTCTAACCGTCTCTCGGGACAACACAAATGACAASOURCE:
CBS IDENTIFICATION SERVICES (REFERENCE: det 07-138)
STRAIN CBL001 / PHOMA.SP (PLEOSPORA) PSI BLAST ASSOCIATED STRAINS:
ORGANISM Xylella fastidiosa Ann-1
Bacteria; Proteobacteria; Gammaproteobacteria; Xanthomonadales;
Xanthomonadaceae; Xylella
ORGANISM Nostoc punctiforme PCC 73102
Bacteria; Cyanobacteria; Nostocales; Nostocaceae; Nostoc.
ORGANISM Magnetospirillum magnetotacticum MS-1
Bacteria; Proteobacteria; Alphaproteobacteria; Rhodospirillales;
Rhodospirillaceae; Magnetospirillum
ORGANISM Bacillus anthracis str. Ames
Bacteria; Firmicutes; Bacillales; Bacillaceae; Bacillus; Bacillus
cereus group.
ORGANISM Aspergillus nidulans FGSC A4
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Eurotiomycetes; Eurotiomycetidae; Eurotiales; Trichocomaceae;
Emericella.
ORGANISM Haemophilus influenzae R2846
Bacteria; Proteobacteria; Gammaproteobacteria; Pasteurellales;
Pasteurellaceae; Haemophilus.
ORGANISM Gibberella zeae PH-1
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae;
Gibberella.
ORGANISM Aspergillus nidulans FGSC A4
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Eurotiomycetes; Eurotiomycetidae; Eurotiales; Trichocomaceae;
Emericella.
ORGANISM Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Bacteria; Firmicutes; Lactobacillales; Leuconostoc.
ORGANISM Pseudomonas aeruginosa PAO1
Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
Pseudomonadaceae; Pseudomonas
“From: perdaniel
[mailto:[email protected]]
Sent: Friday, February 02, 2007 5:29 AM
To: [email protected]
Subject: RE:
South,
“You are a fine and noble personality but you seem to be not very well informed about the idea “general attitude”
If there was interest in my rather involuntary mission I would have noticed more response.
Again, a “foreigner” with a world issue under his arms is not appreciated.
The Political nature is such that Nobody will opt for putting bi-lateral relations at risk, and the media will only go for the matter if public momentum is inevitable.
In the world of science all happen to be equipped with a strong memory.
If one international body would start to point at the other, all would be put seriously at risk.
At this moment the scientific world has started a discussion about AIDS and how ethical all has been.
How ethical all has been!
And the majority still will talk the matter back into the bushes.
I despise activists, conspiracy theorists, alarmists, whatever recalcitrant and organized critique you can think of, but I seriously feel motivated by the idea that you have the democratic spirited right and duty to point things out by mentioning the thing by its proper name.
If later on, you will get to know what this target is doing in culture, and what this accounts for in theory and maybe in practice, you may have a world wide revolution going on.
Basically the organism has a full, but translated blue print of another human being in its design.
This next to a full but translated blue print of at least one mammal, maybe a bird, but for sure insect, parasite, fungi and plant.
An X number of cultures will in a reject like way sometimes throw out a perfect or near perfect genesis of initial dominant gene input.
All this happens to be with the presence of one peculiar and unexpected phenomenon to know; sometimes rapid fusion resulting in the genesis of a known entity but with absence of an embryogenic stage.(….)
The genesis of the insect happens to be more massive and with a bigger dimension than the mammal and human entity!
All used method has been stowed away in one of the most oldest life forms on earth with the use of top technology of already the past.
This type” information” now seems exponentially to proliferate in the environment and to create momentum in body it feels most comfortable with, to know water and soil; including freshwater supplies, lakes, rivers and the vast ocean.
They can’t stop it South, they can’t keep science at pace with the speed nature integrates this type element in every life form that is around.
Cyano and algae, and more general; plankton, represents the biggest body, the biggest weight, the biggest decision maker, because it represents the source code of all life that is present.
Like with any true disaster, people stop thinking and expect that the other ones will do the job.
But not a lot happens; except that they are working on an collective alibi under the name “bio diversity” and “climate change”
Bio means life, and a more proper terminology would be bio climate change.
Scientific models already integrate the introduction of a wide set novel
(uncontrollable) conditions.
They take swabs from all over the world from people that live in remote places, as a reference tool to understand where things for this splendid and organized world have gone wrong.
Sincerely,
Perdaniel”
Anyone can join.
Anyone can contribute.
Anyone can become informed about their world.
"United We Stand" Click Here To Create Your Personal Citizen Journalist Account Today, Be Sure To Invite Your Friends.
Before It’s News® is a community of individuals who report on what’s going on around them, from all around the world. Anyone can join. Anyone can contribute. Anyone can become informed about their world. "United We Stand" Click Here To Create Your Personal Citizen Journalist Account Today, Be Sure To Invite Your Friends.
LION'S MANE PRODUCT
Try Our Lion’s Mane WHOLE MIND Nootropic Blend 60 Capsules
Mushrooms are having a moment. One fabulous fungus in particular, lion’s mane, may help improve memory, depression and anxiety symptoms. They are also an excellent source of nutrients that show promise as a therapy for dementia, and other neurodegenerative diseases. If you’re living with anxiety or depression, you may be curious about all the therapy options out there — including the natural ones.Our Lion’s Mane WHOLE MIND Nootropic Blend has been formulated to utilize the potency of Lion’s mane but also include the benefits of four other Highly Beneficial Mushrooms. Synergistically, they work together to Build your health through improving cognitive function and immunity regardless of your age. Our Nootropic not only improves your Cognitive Function and Activates your Immune System, but it benefits growth of Essential Gut Flora, further enhancing your Vitality.
Our Formula includes: Lion’s Mane Mushrooms which Increase Brain Power through nerve growth, lessen anxiety, reduce depression, and improve concentration. Its an excellent adaptogen, promotes sleep and improves immunity. Shiitake Mushrooms which Fight cancer cells and infectious disease, boost the immune system, promotes brain function, and serves as a source of B vitamins. Maitake Mushrooms which regulate blood sugar levels of diabetics, reduce hypertension and boosts the immune system. Reishi Mushrooms which Fight inflammation, liver disease, fatigue, tumor growth and cancer. They Improve skin disorders and soothes digestive problems, stomach ulcers and leaky gut syndrome. Chaga Mushrooms which have anti-aging effects, boost immune function, improve stamina and athletic performance, even act as a natural aphrodisiac, fighting diabetes and improving liver function. Try Our Lion’s Mane WHOLE MIND Nootropic Blend 60 Capsules Today. Be 100% Satisfied or Receive a Full Money Back Guarantee. Order Yours Today by Following This Link.


————————
MARCIA’S FOLLOW UP VIDEO HERE:
http://www.youtube.com/watch?v=QcV1ngoMikg
————————